We developed Genetic-Epigenetic Tissue Mapping (GETMap) to find out the tissue composition of plasma DNA carrying genetic variants not current in the constitutional genome by means of evaluating their methylation profiles with related tissues. We validated this method by displaying that, in pregnant ladies, circulating DNA carrying fetal-specific alleles was solely placenta-derived. In lung-transplant recipients, we confirmed that, at 72 hours after transplantation, the lung contributed solely a median of 17% to the plasma DNA carrying donor-specific alleles and hematopoietic cells contributed a median of 78%.

In hepatocellular most cancers sufferers, the liver was recognized because the predominant supply of plasma DNA carrying tumor-specific mutations. In a pregnant girl with lymphoma, plasma DNA molecules carrying most cancers mutations and fetal-specific alleles have been precisely proven to be derived from the lymphocytes and placenta, respectively. Analysis of tissue origin for plasma DNA carrying genetic variants is doubtlessly helpful for noninvasive prenatal testing, transplantation monitoring and most cancers screening.  

Natural historical past (NH) research, utilizing observational strategies, are widespread in uncommon and orphan illnesses (80% of which have a genetic part). There is profound curiosity in figuring out genetic mutations driving these illnesses in these research to help the formulation of focused precision medicines. The world regulatory classification of NH research with novel molecular biomarker assortment has not been clearly delineated, presenting researchers with the problem of figuring out how these research are labeled and regulated throughout a number of geographies.

Regulatory provisions for NH research and genetic testing have been obtained from Pharmaceutical Product Development (PPD)’s propriety regulatory intelligence database and by surveying the corporate’s country-specific regulatory specialists. A literature search was carried out in the Google Scholar search engine and PubMed for supplementary info. Lack of harmonization of laws governing NH research with molecular biomarker assortment contributes to the operational complexity of conducting multinational research in orphan and uncommon illnesses.
 Nineteen international locations have been evaluated; 37% labeled NH research with biomarker assortment as noninterventional and 26% required regulatory approval (rising to 47% when molecular biomarker testing was launched). No regulatory provisions for genetic testing might be recognized in 32% of nations, and 58% didn’t have binding necessities for genetic counseling. A set of harmonized worldwide tips for these research would enhance effectivity, and this can be on the horizon with the latest adaption of International Conference on Harmonisation (ICH) guideline E18.

Knowledge and psychosocial affect of genetic counseling and multigene panel testing amongst people with ovarian most cancers

In a pattern of people with ovarian most cancers, we aimed to (a) establish elements related to the psychosocial affect of genetic counseling and multigene panel testing, (b) establish elements related to most cancers genetics information, and (c) summarize patient-reported suggestions to enhance the genetic counseling and multigene panel testing course of. Eligible individuals in this secondary evaluation of quantitative and qualitative survey information have been English-speaking adults with ovarian most cancers. Psychosocial affect was assessed utilizing the Multidimensional Impact of Cancer Risk Assessment (MICRA) questionnaire. Knowledge of most cancers genetics was assessed utilizing the KnowGene scale.

Significant predictors of MICRA and KnowGene scores have been recognized utilizing a number of regression. Open-ended survey merchandise responses have been analyzed utilizing standard content material evaluation. Eighty-seven individuals met eligibility standards. A optimistic genetic take a look at consequence was related to higher hostile psychosocial affect (B = 1.13, p = 0.002). Older age (B = – 0.07, p = 0.044) and being a member of a minority racial or ethnic group (B = – 3.075, p = 0.033) have been related to decrease information, whereas a private historical past of no less than one different sort of most cancers (B = 1.975, p = 0.015) was related to greater information.

In open-ended merchandise responses, individuals wished clinicians to help with household communication, enhance consequence disclosure, and improve affected person and household understanding of outcomes. A subset of people with ovarian most cancers who obtain a optimistic genetic take a look at consequence could also be in danger for hostile psychosocial outcomes. Tailored most cancers genetics training is important to advertise the equitable uptake of focused ovarian most cancers remedy and risk-reducing therapies. Interventions to boost patient-clinician communication in this setting are a analysis precedence.

Genetic-epigenetic tissue mapping for plasma DNA: applications in prenatal testing, transplantation and oncology

Mainstream genetic testing for breast most cancers sufferers: early experiences from the Parkville Familial Cancer Centre

The demand for genetic testing of hereditary breast most cancers genes resembling BRCA1 and BRCA2 has continued to extend with the decreasing prices of testing, raised consciousness in most people, and implications for breast most cancers remedy when a affected person is recognized as having a germline pathogenic variant. Historically inside Australia, sufferers affected by excessive genetic danger breast cancers have been referred to a familial most cancers centre (FCC) for evaluation and testing, ensuing in wait instances for an appointment for pre- and post-test genetic counselling and an elevated demand on the public-funded FCC.

To enhance affected person entry and tempo of genetic testing, in addition to refocus FCC sources, a mainstream scientific genetic testing program was rolled out in September 2017 by means of the Parkville FCC (PFCC) in Australia at 10 hospital websites. This program allows specialist medical doctors of eligible sufferers affected by breast most cancers to rearrange genetic testing instantly at an oncology/surgical appointment and observe up the outcomes as a part of the sufferers’ routine scientific care.

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-b-48T 48T
EUR 493
  • Should the Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-b-96T 96T
EUR 641
  • Should the Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-c-48T 48T
EUR 474
  • Should the Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma or other biological fluids.

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-c-96T 96T
EUR 614
  • Should the Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma or other biological fluids.

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Ch-48T 48T
EUR 454
  • Should the Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Ch-96T 96T
EUR 587
  • Should the Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-g-48T 48T
EUR 503
  • Should the Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-g-96T 96T
EUR 654
  • Should the Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Goat Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Hu-48T 48T
EUR 425
  • Should the Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Hu-96T 96T
EUR 548
  • Should the Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Mu-48T 48T
EUR 435
  • Should the Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Mu-96T 96T
EUR 561
  • Should the Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-p-48T 48T
EUR 493
  • Should the Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-p-96T 96T
EUR 641
  • Should the Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Ra-48T 48T
EUR 454
  • Should the Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Ra-96T 96T
EUR 587
  • Should the Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Rb-48T 48T
EUR 454
  • Should the Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

DLR-BMP4-Rb-96T 96T
EUR 587
  • Should the Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Bone Morphogenetic Protein 4 (BMP4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-b-48Tests 48 Tests
EUR 516

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-b-96Tests 96 Tests
EUR 716

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-c-48Tests 48 Tests
EUR 493

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-c-96Tests 96 Tests
EUR 683

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Ch-48Tests 48 Tests
EUR 470

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Ch-96Tests 96 Tests
EUR 651

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-g-48Tests 48 Tests
EUR 528

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-g-96Tests 96 Tests
EUR 733

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Hu-48Tests 48 Tests
EUR 436

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Hu-96Tests 96 Tests
EUR 601

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Mu-48Tests 48 Tests
EUR 447

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Mu-96Tests 96 Tests
EUR 618

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-p-48Tests 48 Tests
EUR 516

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-p-96Tests 96 Tests
EUR 716

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Ra-48Tests 48 Tests
EUR 470

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Ra-96Tests 96 Tests
EUR 651

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Rb-48Tests 48 Tests
EUR 470

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RDR-BMP4-Rb-96Tests 96 Tests
EUR 651

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-b-48Tests 48 Tests
EUR 494

Bovine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-b-96Tests 96 Tests
EUR 684

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-c-48Tests 48 Tests
EUR 472

Canine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-c-96Tests 96 Tests
EUR 653

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Ch-48Tests 48 Tests
EUR 450

Chicken Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Ch-96Tests 96 Tests
EUR 622

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-g-48Tests 48 Tests
EUR 505

Goat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-g-96Tests 96 Tests
EUR 700

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Hu-48Tests 48 Tests
EUR 418

Human Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Hu-96Tests 96 Tests
EUR 575

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Mu-48Tests 48 Tests
EUR 429

Mouse Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Mu-96Tests 96 Tests
EUR 591

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-p-48Tests 48 Tests
EUR 494

Porcine Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-p-96Tests 96 Tests
EUR 684

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Ra-48Tests 48 Tests
EUR 450

Rat Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Ra-96Tests 96 Tests
EUR 622

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Rb-48Tests 48 Tests
EUR 450

Rabbit Bone Morphogenetic Protein 4 (BMP4) ELISA Kit

RD-BMP4-Rb-96Tests 96 Tests
EUR 622

BMP4 protein

30R-1255 100 ug
EUR 224
Description: Purified recombinant Human BMP4 protein

BMP4 protein

30R-2651 10 ug
EUR 341
Description: Purified recombinant Human BMP4 protein

BMP4 protein

30R-AB029 5 ug
EUR 273
Description: Purified recombinant Human BMP4 protein

BMP4 antibody

20R-2936 100 ul
EUR 393
Description: Rabbit polyclonal BMP4 antibody

BMP4 antibody

70R-12408 100 ug
EUR 403
Description: Rabbit polyclonal BMP4 antibody

BMP4 antibody

70R-12409 100 ug
EUR 403
Description: Rabbit polyclonal BMP4 antibody

BMP4 antibody

70R-16011 50 ul
EUR 435
Description: Rabbit polyclonal BMP4 antibody

BMP4 Antibody

35652-100ul 100ul
EUR 252

BMP4 antibody

38256-100ul 100ul
EUR 252

BMP4 antibody

10R-2148 100 ul
EUR 403
Description: Mouse monoclonal BMP4 antibody

BMP4 antibody

10R-3460 100 ul
EUR 691
Description: Mouse monoclonal BMP4 antibody

BMP4 antibody

10R-B119a 100 ug
EUR 792
Description: Mouse monoclonal BMP4 antibody

BMP4 antibody

10R-B119B 500 ug
EUR 273
Description: Mouse monoclonal BMP4 antibody

BMP4 Antibody

43852-100ul 100ul
EUR 252

BMP4 Antibody

1-CSB-PA002740GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BMP4 Antibody

1-CSB-PA05799A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:1000

BMP4 Antibody

1-CSB-PA763132
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BMP4 Antibody

DF6461 200ul
EUR 304
Description: BMP4 Antibody detects endogenous levels of total BMP4.

BMP4 Antibody

1-CSB-PA212919
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150

BMP4 Antibody

AF5175 200ul
EUR 304
Description: BMP4 Antibody detects endogenous levels of total BMP4.

BMP4 Antibody

BF0696 200ul
EUR 376
Description: BMP4 antibody detects endogenous levels of total BMP4.

BMP4 Antibody

ABD6461 100 ug
EUR 438

BMP4 Antibody

ABF5175 100 ug
EUR 438

anti-BMP4

LF-PA0093 100 ul
EUR 334
Description: Rabbit polyclonal to BMP4

pENTR223- BMP4

PVT10009 2 ug
EUR 266

pCDNA3.1- BMP4

PVT10207 2 ug
EUR 301

BMP4 Rabbit pAb

A11315-100ul 100 ul
EUR 308

BMP4 Rabbit pAb

A11315-200ul 200 ul
EUR 459

BMP4 Rabbit pAb

A11315-20ul 20 ul
EUR 183

BMP4 Rabbit pAb

A11315-50ul 50 ul
EUR 223

BMP4 Rabbit mAb

A11405-100ul 100 ul
EUR 410

BMP4 Rabbit mAb

A11405-200ul 200 ul
EUR 571

BMP4 Rabbit mAb

A11405-20ul 20 ul
EUR 221

BMP4 Rabbit mAb

A11405-50ul 50 ul
EUR 287

BMP4 Rabbit pAb

A1565-100ul 100 ul
EUR 308

BMP4 Rabbit pAb

A1565-200ul 200 ul
EUR 459

BMP4 Rabbit pAb

A1565-20ul 20 ul
EUR 183

BMP4 Rabbit pAb

A1565-50ul 50 ul
EUR 223

BMP4 Rabbit pAb

A11922-100ul 100 ul
EUR 384

BMP4 Rabbit pAb

A11922-200ul 200 ul Ask for price

BMP4 Rabbit pAb

A11922-20ul 20 ul Ask for price

BMP4 Rabbit pAb

A11922-50ul 50 ul
EUR 265

BMP4 Blocking Peptide

33R-11056 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BMP4 antibody, catalog no. 70R-12409

Polyclonal BMP4 Antibody

APR04912G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMP4 . This antibody is tested and proven to work in the following applications:

BMP4 Blocking Peptide

DF6461-BP 1mg
EUR 195

BMP4 Rabbit pAb

A0425-100ul 100 ul
EUR 308

BMP4 Rabbit pAb

A0425-200ul 200 ul
EUR 459

BMP4 Rabbit pAb

A0425-20ul 20 ul
EUR 183

BMP4 Rabbit pAb

A0425-50ul 50 ul
EUR 223

BMP2 + BMP4 antibody

70R-BG001 50 ug
EUR 553
Description: Affinity purified Goat polyclonal BMP2 + BMP4 antibody

Anti-BMP4 Antibody

A00321 100ug/vial
EUR 294

BMP4 Blocking Peptide

AF5175-BP 1mg
EUR 195

BMP4 Conjugated Antibody

C43852 100ul
EUR 397

BMP4 Conjugated Antibody

C35652 100ul
EUR 397

BMP4 Conjugated Antibody

C38256 100ul
EUR 397

BMP4 Blocking Peptide

BF0696-BP 1mg
EUR 195

BMP4 cloning plasmid

CSB-CL002740HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgattcctggtaaccgaatgctgatggtcgttttattatgccaagtcctgctaggaggcgcgagccatgctagtttgatacctgagacggggaagaaaaaagtcgccgagattcagggccacgcgggaggacgccgctcagggcagagccatgagctcctgcgggacttcgagg
  • Show more
Description: A cloning plasmid for the BMP4 gene.

BMP4 Polyclonal Antibody

A55459 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- BMP4 antibody

FNab00919 100µg
EUR 505.25
  • Immunogen: bone morphogenetic protein 4
  • Uniprot ID: P12644
  • Gene ID: 652
  • Research Area: Stem Cells, Developmental biology
Description: Antibody raised against BMP4

anti-BMP4 (10F4B4)

LF-MA30345 100 ul
EUR 486
Description: Mouse Monoclonal to BMP4

Anti-BMP4 antibody

PAab00919 100 ug
EUR 355

Anti-BMP4 Antibody

PB9688 100ug/vial
EUR 294

pT7- His- bmp4

PVT10142 2 ug
EUR 301

pDonR233- bmp4 Plasmid

PVT7139 2 ug
EUR 266

pCDNA3.1 (+)- bmp4 Plasmid

PVT7206 2 ug
EUR 266

pcDNA3.1-BMP4 Plasmid

PVTB00078-2b 2 ug
EUR 356

Anti-BMP4 antibody

STJ113071 100 µl
EUR 277
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers.

Anti-BMP4 antibody

STJ113465 100 µl
EUR 393
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers.

Anti-BMP4 antibody

STJ73557 100 µg
EUR 359

Anti-BMP4 Antibody

STJ500264 100 µg
EUR 515

Anti-BMP4 antibody

STJ22814 100 µl
EUR 277
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers.

Anti-BMP4 antibody

STJ22815 100 µl
EUR 277
Description: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers.

Human BMP4 ELISA Kit

55R-1563 1 kit
EUR 651
Description: ELISA Kit for detection of BMP4 in the research laboratory

BMP4 Antibody, HRP conjugated

1-CSB-PA05799B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BMP4 Antibody, FITC conjugated

1-CSB-PA05799C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BMP4 Antibody, Biotin conjugated

1-CSB-PA05799D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP4. Recognizes BMP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human BMP4 ELISA Kit

ELA-E0014h 96 Tests
EUR 824

Human BMP4 ELISA Kit

EHB0550 96Tests
EUR 521

Goat BMP4 ELISA Kit

EGTB0550 96Tests
EUR 521

Bovine BMP4 ELISA Kit

EBB0550 96Tests
EUR 521

Canine BMP4 ELISA Kit

ECB0550 96Tests
EUR 521

Chicken BMP4 ELISA Kit

ECKB0550 96Tests
EUR 521

Anserini BMP4 ELISA Kit

EAB0550 96Tests
EUR 521

Mouse BMP4 shRNA Plasmid

20-abx969368
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BMP4 shRNA Plasmid

20-abx950447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BMP4 recombinant monoclonal antibody

A5543 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BMP4 for WB, IF,ELISA

Mouse BMP4 ELISA Kit

EMB0550 96Tests
EUR 521

Rat BMP4 ELISA Kit

ERB0550 96Tests
EUR 521

In this mannequin, the specialist physician is accountable for any remedy implications of the genetic take a look at consequence, and the PFCC is accountable for consequence interpretation, future most cancers danger, household cascade testing and segregation testing the place warranted. To date this system has had profitable uptake, a notable pathogenic variant detection fee, diminished the burden on the PFCC enabling a reallocation of sources and has streamlined the method of genetic testing for eligible sufferers. Investigation into the affected person and clinician experiences of the mainstream program is required.